teaching grammar page 37        structure and analysis        fast track grammar review        instructional methods for tutorial students

Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

Ngày tải lên : 06/03/2014, 22:21
... domains G and II and domains III, IV and V In the S aureus EF-G structure, this loop has a bent conformation, and packs against domain III and interacts with the linker between domains III and IV ... in the PDB Structure superposition was performed with o [47] Acknowledgements We thank the SLS and ESRF for beam time and support during data collection, and K Backbro and C S ¨ Koh for comments ... hydrolysis and translocation [25] FA binds to a pocket between domains I, II and III of EF-G, and seems to lock EF-G in a conformation intermediate between the GTP-bound and GDP-bound forms [22]...
  • 15
  • 474
  • 0
presentation and analysis of a multi-dimensional interpolation function for non-uniform data microsphere projection

presentation and analysis of a multi-dimensional interpolation function for non-uniform data microsphere projection

Ngày tải lên : 30/10/2014, 20:12
... which are designed to handle non-uniform data This will exclude both Bilinear and Trilinear interpolations In Chapter 2, we discuss existing non-uniform interpolation methods and their implementations ... Chapter provides a detailed analysis of the Microsphere Projection algorithm In Chapter we present an analysis and comparison of various 1D, 2D and 3D case studies and the experimental results ... range (-1,1) x := rand(-1,1) y := rand(-1,1) z := rand(-1,1) vectorSize := sqrt (x*x + y*y + z*z) // if the vector these points form is outside the unit sphere, // disregard and find a new vector...
  • 157
  • 326
  • 0
moodle 2 for teaching 7-14 year olds [electronic resource] beginner's guide effective e-learning for younger students, using moodle as your classroom assistant

moodle 2 for teaching 7-14 year olds [electronic resource] beginner's guide effective e-learning for younger students, using moodle as your classroom assistant

Ngày tải lên : 29/05/2014, 17:42
... Moodle for me? Making our course home page look more like a web page Time for action – adding image links to our topic sections Time for action – putting our activities into web pages Time for action ... Online Interviews) and has peer-reviewed articles and books on technology-enhanced learning Dr Deutsch also serves as chair for doctoral students She is currently researching and writing a book ... technologies have to enhance learning and support teaching, business, and life Recent roles and responsibilities which have enhanced her knowledge, understanding, and application of a variety of tools...
  • 245
  • 389
  • 0
A study on applying Group work to increase quality and quantity of language use at High School for Gifted Students = Nghiên cứu về việc áp dụng hoạt động nhóm n

A study on applying Group work to increase quality and quantity of language use at High School for Gifted Students = Nghiên cứu về việc áp dụng hoạt động nhóm n

Ngày tải lên : 28/03/2015, 08:59
... collection methods: questionnaire and interview Clarification has also been given to the data analysis methods and process The presentation and interpretation of findings from such analysis are ... become a standard and dominant approach in Language Teaching Grammar Translation Method is a way of studying a language that approaches the language first through detailed analysis of its grammar ... would be analyzed and then demonstrated for comparison and interpretation Besides, some of the quotes from the interviews with teachers and students would be cited by summaries and quotation into...
  • 53
  • 820
  • 0
ANALYSIS OF MICROBIAL COMMUNITY STRUCTURE AND IN SITU ACTIVITY OF NITRIFYING BIOFILMS

ANALYSIS OF MICROBIAL COMMUNITY STRUCTURE AND IN SITU ACTIVITY OF NITRIFYING BIOFILMS

Ngày tải lên : 05/09/2013, 08:40
... coefficients of 1.38×10-5 cm2 s-1 for NH4+, 1.23×10-5 cm2 s-1 for NO2-, and 1.23× 10-5 cm2 s-1 for NO3- at 20°C were used for the calculations (Andrussow, 1969) RESULTS AND DISCUSSION Spatial Distributions ... hybridization (FISH) and microsensor techniques have a high spatial (at a single-cell resolution) and temporal resolution and great potential, and provide reliable and direct information about the ... and the use of microelectrodes Appl Environ Microbiol 65: 3182-3191 Okabe, S., H Satoh, and Y Watanabe 2001 Analysis of microbial structure and function of nitrifying biofilms Meth Enzymol 337: ...
  • 10
  • 712
  • 0
An Analysis of Domestic Water Demand Structure and Water Recycling in Beijing

An Analysis of Domestic Water Demand Structure and Water Recycling in Beijing

Ngày tải lên : 05/09/2013, 10:17
... saving, and environmental attitude for reclaimed water use An average figure for monthly frequency of water use was required for showering and washing, and this had to be estimated separately for ... and boiling water, 27% for showering and foot washing, 18% for toilet flushing, and 14% for the washing machine Water use in washing and showering increased from 12 to 17% and from 16 to 25%from ... use and patterns of behavior, such as frequency of showering and washing, were different in each season: 53L, 63L, and 51L in spring and fall, summer, and winter, respectively Thus, the demand for...
  • 12
  • 515
  • 0
Báo cáo khoa học: Genomic structure and expression analysis of the RNase j family ortholog gene in the insect Ceratitis capitata pptx

Báo cáo khoa học: Genomic structure and expression analysis of the RNase j family ortholog gene in the insect Ceratitis capitata pptx

Ngày tải lên : 23/03/2014, 06:20
... FEBS T N Rampias et al Genomic structure and expression analysis of the Cc RNase epidermis and intestine of 6-day-old larvae and adult heads and ovaries, was blotted and hybridized using the Cc ... Genomic structure and expression analysis of the Cc RNase A B FEBS Journal 275 (2008) 6217–6227 ª 2008 The Authors Journal compilation ª 2008 FEBS 6223 Genomic structure and expression analysis ... MA, USA) 9600 thermal cycler, and the cycle conditions were as follows: one cycle at 95 °C for min, followed by 35 cycles at 95 °C for min, 56 °C for and 72 °C for min, with a 10 final extension...
  • 11
  • 479
  • 0
Báo cáo khoa học: Genomic structure, promoter analysis and functional mutation pptx

Báo cáo khoa học: Genomic structure, promoter analysis and functional mutation pptx

Ngày tải lên : 23/03/2014, 21:21
... (5¢ to 3¢) Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse CCCAAGTTCTGTGTCCTCCA One AQPap-G264V homozygous subject and two AQPap ... Materials and methods (C) Tissue distribution of mRNAs for AQPap and AQPap-like genes Total RNAs from indicated human tissues were subjected to RT-PCR analysis using primers specific for AQPap and AQPap-like, ... protocol and then used for transfection For analysis of the regulation by pioglitazone (PGZ), an equal volume of DMEM containing 20% fetal bovine serum and 20 lM PGZ was added h after transfection, and...
  • 13
  • 511
  • 0
The intellectual structure and substance of the knowledge utilization field: A longitudinal author co-citation analysis, 1945 to 2004 pdf

The intellectual structure and substance of the knowledge utilization field: A longitudinal author co-citation analysis, 1945 to 2004 pdf

Ngày tải lên : 11/08/2014, 05:21
... (publications) and the actual processes of forming knowledge [106] Merton is cited in this decade for the first and revised editions of his book: "Social Theory and Social Structure" [107,108], and for ... Ryan, and Wilkening He worked on projects in many countries; he was invited to speak widely and often He had many graduate students and colleagues and was known for his generosity and gift for ... University, Umea, Sweden was a consultant on the project and advised on methods, software training and use, and reviewed the final work for technical and methodological accuracy His work was supported...
  • 22
  • 393
  • 0
báo cáo khoa học: " The intellectual structure and substance of the knowledge utilization field: A longitudinal author co-citation analysis, 1945 to 2004" potx

báo cáo khoa học: " The intellectual structure and substance of the knowledge utilization field: A longitudinal author co-citation analysis, 1945 to 2004" potx

Ngày tải lên : 11/08/2014, 16:21
... (publications) and the actual processes of forming knowledge [106] Merton is cited in this decade for the first and revised editions of his book: "Social Theory and Social Structure" [107,108], and for ... Ryan, and Wilkening He worked on projects in many countries; he was invited to speak widely and often He had many graduate students and colleagues and was known for his generosity and gift for ... University, Umea, Sweden was a consultant on the project and advised on methods, software training and use, and reviewed the final work for technical and methodological accuracy His work was supported...
  • 22
  • 316
  • 0
the structure and meaning of president nguyen minh triet’s speech addressed on the occasion of the 1000th anniversary of the foundation of thang long – hanoi a systemic functional analysis

the structure and meaning of president nguyen minh triet’s speech addressed on the occasion of the 1000th anniversary of the foundation of thang long – hanoi a systemic functional analysis

Ngày tải lên : 28/02/2015, 11:54
... the political text analysis 1.4 Methods of the Study With a view to analyzing the meaning and structure of a Vietnamese text, descriptive and analytical methods are used The former is concerned ... focuses on its meaning and structure  Chapter four – Conclusion – summarizes the results of the study and offers some suggestions for teaching and learning as well as for further studies 4 ... speech in a formal, convincing and forceful way in the form of the following parts: 1) Salutation 2) The expression of gratitude and honor 3) A review of the Thang Long – Hanoi’s history and achievement...
  • 69
  • 445
  • 1
High school teachers' perceptions and attitudes towards applying communicative language teaching in teaching grammar = Nhận thức và thái độ của giáo viên cấp ba

High school teachers' perceptions and attitudes towards applying communicative language teaching in teaching grammar = Nhận thức và thái độ của giáo viên cấp ba

Ngày tải lên : 28/03/2015, 10:08
... teaching 12 1.3 The role of grammar in foreign language teaching and learning 13 iv 1.4 Grammar teaching in the light of CLT 14 1.5 Teachers’ perceptions and attitudes to grammar teaching in the light ... background for the thesis This chapter focuses on five main points: Communicative Language Teaching, Grammar, The role of grammar in foreign language teaching and learning, Grammar teaching in ... explicit rules and carefully considered examples 1.3 The role of grammar in foreign language teaching and learning Grammarians give strong support to grammar teaching They think grammar gives...
  • 64
  • 962
  • 1
Computational methods for structure activity relationship analysis and activity prediction

Computational methods for structure activity relationship analysis and activity prediction

Ngày tải lên : 26/11/2015, 09:53
... studies and for his constant guidance and support I thank Prof Dr Michael G¨ utschow for reviewing my thesis as a co-referent I also thank Prof Dr Thorsten Lang and Prof Dr Thomas Schultz for being ... continuous, discontinuous and heterogeneous, helps to choose the relevant application for analysis and/ or prediction Numerical SAR Analysis Complementing the activity landscape analysis, numerical ... potential candidates for further exploration Therefore, the SARM data structure provides a link between descriptive SAR analysis and prospective compound design Predictive Approaches Activity landscapes...
  • 146
  • 343
  • 0
ANALYSIS FOR STRUCTURE AND FUNCTION OF AN ECOSYSTEM HUMAN IMPACTS, CONSEQUENCES AND SOLUTIONS

ANALYSIS FOR STRUCTURE AND FUNCTION OF AN ECOSYSTEM HUMAN IMPACTS, CONSEQUENCES AND SOLUTIONS

Ngày tải lên : 28/05/2016, 09:28
... Location Biotics and abiotics Energy and material flow Human impacts, consequences and solutions Conclusion LOCATION  Thong Nhat Park  Peninsula : 1200 m2  Including : mainland, lake, plants, ... Planning the rubbish dumps and quick transporting the waste as soon as possible  More rules (including penalties) for the restaurant and visitors to keep the park green, clean and beautiful CONCLUSIONS ... Cirrhinus molitorella Tilapia Catfish (order Siluriformes, class Actinopterygii)  Chinese Hypophthalmichthys  Earthworm (order Siluriformes, class Oligochaeta)  Insects (ant, butterfly)  ...
  • 13
  • 206
  • 0
Data Security Policy - Structure and Guidelines

Data Security Policy - Structure and Guidelines

Ngày tải lên : 17/09/2012, 09:40
... of and degree of reliance on the information systems and to the severity, probability, and extent of potential for direct and indirect, tangible and intangible harm Data Security Policy - Structure ... monitoring and audit for policy compliance 13 Firewall implementation and management 14 Virus prevention and protection 15 System and network ownership and management 16 End user accountability and ... platforms s The execution and review of all audit trails s All incident response and reporting s All other tasks necessary to support this policy Policy Review A policy review should be performed...
  • 20
  • 586
  • 2
Ensuring Financial Stability: Financial Structure and the Impact of Monetary Policy on Asset Prices

Ensuring Financial Stability: Financial Structure and the Impact of Monetary Policy on Asset Prices

Ngày tải lên : 24/10/2012, 09:40
... for Denmark, Switzerland, Spain, Finland, France, Germany, Ireland, Italy, the Netherlands, Norway and the UK, a threemonth Treasury bill rate for Belgium, Sweden and the US, and a three-month commercial ... paper rate for Australia, Canada and Japan.13 All interest rates are from the OECD's MEI For Finland and Denmark missing data for 1986 were replaced with data from the IFS (call money rate) For the ... Goodhart, Charles A.E and Boris Hofmann (2007a), House Prices and the Macroeconomy: Implications for Banking and Price Stability, Oxford University Press, Oxford Goodhart, Charles A.E and Boris Hofmann...
  • 35
  • 793
  • 0
The application of games in teaching grammar with reference to tieng anh 10 textbook at ha trung high school, thanh hoa province

The application of games in teaching grammar with reference to tieng anh 10 textbook at ha trung high school, thanh hoa province

Ngày tải lên : 07/11/2012, 14:44
... the role of grammar and the importance of students motivation in teaching and learning grammar? - What benefits does the application of games in teaching grammar bring to teachers and students? ... time for a grammar lesson with games and instead of moans and whining, the teacher and the students get smiles and excitement 1.3.1 Benefits of teaching grammar with games Arif Saricoban and Esen ... Esen Metin (2000), authors of "Songs, Verse and Games for Teaching Grammar" explain how and why games work for teaching grammar in class They say, "Games and problem-solving activities have a purpose...
  • 39
  • 1.6K
  • 8
The relationship between an organization’s structure and culture and the effects on business performance

The relationship between an organization’s structure and culture and the effects on business performance

Ngày tải lên : 12/04/2013, 21:50
... satisfaction and expert power Finally, person culture takes individual as central focus and talent of individual is target for structure exists As we mentioned about organizational structure and culture ... applied a functional structure This type of structure is effective for managing and easy to focus on product group “This unique structure enables Mozilla to financially support and cultivate competitive, ... entrepreneurial style and spirit, good judgment and consensus building skills…etc The relationship between an organization’s structure and culture and the effects on business performance: As we noted,...
  • 10
  • 717
  • 1

Xem thêm